Test PCR primers with blastn

<< Return to the Archive

Share to: 
Sandra Porter

When we make primer sequences for an assay, two characteristics we're concerned with are the specificity of the primers and the sensitivity.

We can use blastn to evaluate whether or not our primers are likely to work.

Specificity: The specificity of a primer set is related to whether the primers are binding only to the sequences that we want to detect or to additional sequences. If our primers bind to lots of sequences - or even unrelated sequences- then they are probably not specific enough. If we made primers that were complementary to a polyA addition site or to an Alu sequence, we would have problems since the primers might bind to many sites in a genome.

Sensitivity: The sensitivity of a primer set is related to whether or not the primers detect the sequences that we want to detect. If they do not detect the sequences that we wish to see, then the test isn't sensitive enough.

We are going to blastn to test two sets of primers that might be used in a PCR experiment and try to determine the following things:

1. What sequence do the primers detect?

2. Do the primers detect more than one sequence and does this make sense based on what you can learn about the sequences?

3. How big would you expect the PCR product to be? - if multiple sequences were detected, find the sizes for the two of the amplification products.

Here are two sets of primers:

1. Set 1
Forward 5' CAACTCGCCTGCATGAAGC 3'
Reverse 5' GGGAATCTCCGGATCTATGCT 3'

2. Set 2
forward 5' CAGCAGCTTTCATTGGAAACAC 3'
reverse 5' GTAGGGAAGTAGGTTGAGGTCG 3'

Instructions
1. Go to the NCBI.
2. pick blastn
3. enter your primer sequences in this format:

forwardprimerNNNNNNNNNNNNNNNNNNNNNNNNreversecomplementofreverseprimer

click BLAST

Categories: