Digital Biology Friday: A microbiology blast puzzler

<< Return to the Archive

Share to: 
Sandra Porter

Here's a fun puzzler for you to figure out.

The blast graph is here:

i-02f5f2aaa95bc8ab8660ebaba090a49e-graph.png

The table with scores is here, click the table to see a bigger image:

i-c6f0f4e4fc0d3b6f0f299d302de71acd-smaller_table.png

And here is the puzzling part: Why is the total score so high?

If you want to repeat this for yourself, go here.

You can use this sequence as a query (it's the same one that I used).

>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA
CACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTG
ATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGAGGAGG
AAGGCATTGTGGTTAATAACCGCAGTGATTGACGTTACTCGCAGAAGAAGCACCGGCTAAC
TCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAA
AGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCA
TTCGAAACTGGCAGGCTAGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAAT
GCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACGAAGACTGACGCTC
AGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGAT
GTCTATTTGAAGGTTGTTCCCTTGAGGAGTGGCTTTCGGAGCTAACGCGTTAAATAGACCGCC
TGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTG
GAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAC

And change the database to Reference genomic sequences.

I'll post the answer next Friday.